ID: 1158878311_1158878316

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1158878311 1158878316
Species Human (GRCh38) Human (GRCh38)
Location 18:61753122-61753144 18:61753148-61753170
Sequence CCCTGAGAAGCGAAGCTCAGGCA GCAGCAGTGGGCAAAGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 128} {0: 1, 1: 0, 2: 3, 3: 53, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!