ID: 1158954163_1158954175

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1158954163 1158954175
Species Human (GRCh38) Human (GRCh38)
Location 18:62523605-62523627 18:62523631-62523653
Sequence CCGCCGCCGCCCCGGGGACTCGG GCCTGTTGCTGGTGGAGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 331} {0: 1, 1: 0, 2: 2, 3: 21, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!