ID: 1158954163_1158954184

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1158954163 1158954184
Species Human (GRCh38) Human (GRCh38)
Location 18:62523605-62523627 18:62523650-62523672
Sequence CCGCCGCCGCCCCGGGGACTCGG GCGGCGGGGGCGGGTATGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 331} {0: 1, 1: 0, 2: 0, 3: 17, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!