ID: 1158976461_1158976479

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1158976461 1158976479
Species Human (GRCh38) Human (GRCh38)
Location 18:62715603-62715625 18:62715641-62715663
Sequence CCGTCTCCCACCTCCGCCTCATC CGCTGCCTCCGGAGCTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 138, 4: 1419} {0: 1, 1: 0, 2: 3, 3: 36, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!