ID: 1159064995_1159065008

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1159064995 1159065008
Species Human (GRCh38) Human (GRCh38)
Location 18:63559877-63559899 18:63559928-63559950
Sequence CCCACAGTTTTCTTCTCTTCCCA CATTGTGGGTGGAATAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 562} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!