ID: 1159110759_1159110762

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1159110759 1159110762
Species Human (GRCh38) Human (GRCh38)
Location 18:64053949-64053971 18:64053965-64053987
Sequence CCTCCAAGCAGGAGGAAAGCAAT AAGCAATACTAAATGGAATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!