ID: 1159118047_1159118051

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1159118047 1159118051
Species Human (GRCh38) Human (GRCh38)
Location 18:64137362-64137384 18:64137376-64137398
Sequence CCGCCCAGTTTGTGGCACTTTGT GCACTTTGTTAGGACAACCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 92, 4: 2827}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!