ID: 1159152568_1159152579

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1159152568 1159152579
Species Human (GRCh38) Human (GRCh38)
Location 18:64538772-64538794 18:64538811-64538833
Sequence CCTCTTCTCTCTTTTGTTGGCCT CAGGCAGCAAGGTGGGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 542} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!