ID: 1159241692_1159241702

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1159241692 1159241702
Species Human (GRCh38) Human (GRCh38)
Location 18:65750780-65750802 18:65750816-65750838
Sequence CCTCCTCTCCTGCGCGCCCTCTC CCGCGCGCTCCCGCTGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 630} {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!