ID: 1159287787_1159287791

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1159287787 1159287791
Species Human (GRCh38) Human (GRCh38)
Location 18:66375451-66375473 18:66375496-66375518
Sequence CCTGCTATCTTCTGCAGATAACT CTTGGCCTGTTACTGGGCTTTGG
Strand - +
Off-target summary No data {0: 169, 1: 171, 2: 103, 3: 76, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!