ID: 1159299465_1159299469

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1159299465 1159299469
Species Human (GRCh38) Human (GRCh38)
Location 18:66544016-66544038 18:66544050-66544072
Sequence CCTACAAATGATCCCTGTGGGGT CTTCAAATACATAATATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95} {0: 1, 1: 0, 2: 0, 3: 19, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!