ID: 1159306618_1159306623

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1159306618 1159306623
Species Human (GRCh38) Human (GRCh38)
Location 18:66651747-66651769 18:66651792-66651814
Sequence CCAGCTTTTTGTCTATTTAAACT AGCTGAGGAAATGACTAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!