ID: 1159325782_1159325792 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1159325782 | 1159325792 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 18:66915383-66915405 | 18:66915400-66915422 |
| Sequence | CCAGAGCCTGGGAAGGGTAGTTG | TAGTTGGGGAGGAGGGTGGAGGG |
| Strand | - | + |
| Off-target summary | {0: 4, 1: 74, 2: 579, 3: 1271, 4: 1821} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||