ID: 1159337072_1159337076

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1159337072 1159337076
Species Human (GRCh38) Human (GRCh38)
Location 18:67082029-67082051 18:67082055-67082077
Sequence CCTCAATTTGCATTGGCTCACCC AATTTGCATGCAATTGAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 38, 3: 173, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!