ID: 1159398640_1159398647

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1159398640 1159398647
Species Human (GRCh38) Human (GRCh38)
Location 18:67900284-67900306 18:67900336-67900358
Sequence CCTAGGACTTGAATCCGTAAAAC TGACATTGATCTTGGCAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!