ID: 1159496650_1159496652

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1159496650 1159496652
Species Human (GRCh38) Human (GRCh38)
Location 18:69216198-69216220 18:69216220-69216242
Sequence CCTTCCTTCTTATTGAAATGGAA AAAGTATTAATATCAAGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 365} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!