ID: 1159502120_1159502126

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1159502120 1159502126
Species Human (GRCh38) Human (GRCh38)
Location 18:69286764-69286786 18:69286788-69286810
Sequence CCCAAATACTTCCCATGAGGCTG CCCTCCCAGCACTGCCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 44, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!