ID: 1159525246_1159525247

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1159525246 1159525247
Species Human (GRCh38) Human (GRCh38)
Location 18:69580700-69580722 18:69580731-69580753
Sequence CCTTCTAGCTATTTGAAAATATA TGTTAATTATAGTCACCTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 21, 3: 63, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!