ID: 1159594436_1159594444

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1159594436 1159594444
Species Human (GRCh38) Human (GRCh38)
Location 18:70369510-70369532 18:70369549-70369571
Sequence CCCTAGAACCTGCCATATTTTAA CAGCCTGTGGACCAAAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 270} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!