ID: 1159624397_1159624411

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1159624397 1159624411
Species Human (GRCh38) Human (GRCh38)
Location 18:70675350-70675372 18:70675384-70675406
Sequence CCAAAACCTGAGAATGGGGGTGG GTGTGTAAAGGGATGGGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 78, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!