ID: 1159634665_1159634675

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1159634665 1159634675
Species Human (GRCh38) Human (GRCh38)
Location 18:70790091-70790113 18:70790129-70790151
Sequence CCTTCCACCAGCTCCCTCTCATG TACAATTCGAGGTGAGATTTGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 98, 3: 701, 4: 2378} {0: 54, 1: 1836, 2: 10721, 3: 11840, 4: 8164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!