ID: 1159634665_1159634676

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1159634665 1159634676
Species Human (GRCh38) Human (GRCh38)
Location 18:70790091-70790113 18:70790132-70790154
Sequence CCTTCCACCAGCTCCCTCTCATG AATTCGAGGTGAGATTTGGGTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 98, 3: 701, 4: 2378} {0: 51, 1: 1827, 2: 11312, 3: 12512, 4: 8835}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!