ID: 1159640065_1159640069

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1159640065 1159640069
Species Human (GRCh38) Human (GRCh38)
Location 18:70853772-70853794 18:70853787-70853809
Sequence CCCAGCCTCCGCTGGGTCCAACG GTCCAACGTCACCACAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!