ID: 1159651274_1159651277

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1159651274 1159651277
Species Human (GRCh38) Human (GRCh38)
Location 18:70981980-70982002 18:70981999-70982021
Sequence CCAGCTTCCTCTACATAAAGTGG GTGGACTCAGTAAATGTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!