ID: 1159679107_1159679109

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1159679107 1159679109
Species Human (GRCh38) Human (GRCh38)
Location 18:71325445-71325467 18:71325482-71325504
Sequence CCTGAAAAAACTGCAAGTCAGAG TTGTGATTATGAAGGTGACGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!