ID: 1159702846_1159702853

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1159702846 1159702853
Species Human (GRCh38) Human (GRCh38)
Location 18:71650863-71650885 18:71650890-71650912
Sequence CCGCTGGGAAGGCACCCAAATCC AGGGCCTGAACAGAATATAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 24, 3: 165, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!