ID: 1159702849_1159702858

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1159702849 1159702858
Species Human (GRCh38) Human (GRCh38)
Location 18:71650877-71650899 18:71650929-71650951
Sequence CCCAAATCCCTTTAGGGCCTGAA TTTCTCTTTGTCTTCTAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 59, 4: 1027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!