ID: 1159708002_1159708007

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1159708002 1159708007
Species Human (GRCh38) Human (GRCh38)
Location 18:71717423-71717445 18:71717440-71717462
Sequence CCCACAAGTTGCCCAAGCTCAGC CTCAGCCAGTGGTTGATCCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!