ID: 1159716913_1159716914

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1159716913 1159716914
Species Human (GRCh38) Human (GRCh38)
Location 18:71835422-71835444 18:71835451-71835473
Sequence CCTTTAATCTGGTGGGCACAATC GCTTCTAGCAAATGTAAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 39, 3: 202, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!