ID: 1159739020_1159739021

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1159739020 1159739021
Species Human (GRCh38) Human (GRCh38)
Location 18:72141737-72141759 18:72141750-72141772
Sequence CCAATAGCAGTAGTGATCACCCT TGATCACCCTGAGACCTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!