ID: 1159802680_1159802689

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1159802680 1159802689
Species Human (GRCh38) Human (GRCh38)
Location 18:72920395-72920417 18:72920444-72920466
Sequence CCCATAATGACTGTGCTCTCCCT ACACCACATGGCCACTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 30, 3: 114, 4: 337} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!