ID: 1159833393_1159833396

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1159833393 1159833396
Species Human (GRCh38) Human (GRCh38)
Location 18:73306057-73306079 18:73306096-73306118
Sequence CCTCTCAATGCGTTCAATGTTTC CTGGTACTAACTTGGAATTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!