ID: 1159903016_1159903020

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1159903016 1159903020
Species Human (GRCh38) Human (GRCh38)
Location 18:74065885-74065907 18:74065900-74065922
Sequence CCCTTCACCCACTGTGGATTCCT GGATTCCTAAAGCCATTAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!