ID: 1159931399_1159931410

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1159931399 1159931410
Species Human (GRCh38) Human (GRCh38)
Location 18:74316021-74316043 18:74316051-74316073
Sequence CCACCCGCCCTTTCCTCCCCCTG GCCTGACGCATCTGCAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 113, 4: 1151} {0: 1, 1: 0, 2: 1, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!