ID: 1159954637_1159954648

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1159954637 1159954648
Species Human (GRCh38) Human (GRCh38)
Location 18:74510596-74510618 18:74510635-74510657
Sequence CCAGAGAGCCCCACCTTGCGAGA GGCCTGGAGCCACAGCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 88} {0: 1, 1: 0, 2: 3, 3: 42, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!