ID: 1159966962_1159966963

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1159966962 1159966963
Species Human (GRCh38) Human (GRCh38)
Location 18:74604369-74604391 18:74604390-74604412
Sequence CCAGGGGTCTTAGGTTTAACTCA CACACTTCCCAGACCTCCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!