ID: 1159973405_1159973412

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1159973405 1159973412
Species Human (GRCh38) Human (GRCh38)
Location 18:74680586-74680608 18:74680626-74680648
Sequence CCCTCTGTTTTTTTGTATGTGTG AAGCTGGTTTATAGGAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 239, 4: 2194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!