ID: 1160062089_1160062093

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1160062089 1160062093
Species Human (GRCh38) Human (GRCh38)
Location 18:75540055-75540077 18:75540103-75540125
Sequence CCAAAAGAAGTTCTTCAAATAGA TTGAATCTGCAGAAGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 40, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!