ID: 1160157015_1160157020

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1160157015 1160157020
Species Human (GRCh38) Human (GRCh38)
Location 18:76441941-76441963 18:76441962-76441984
Sequence CCTCCTCGGCCGGGGCGCGCGTG TGCGGCTGGCCTCGACTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125} {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!