ID: 1160211064_1160211068

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1160211064 1160211068
Species Human (GRCh38) Human (GRCh38)
Location 18:76880260-76880282 18:76880283-76880305
Sequence CCGCAGCCTGGGCAGCAGCTGAG CATCACAGTGGGCATCAACCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 217, 4: 4960} {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!