ID: 1160242273_1160242280

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1160242273 1160242280
Species Human (GRCh38) Human (GRCh38)
Location 18:77132507-77132529 18:77132549-77132571
Sequence CCGCGGTCCCCACTCGGAGGGGC AGCAGCCCGCCCGTCCCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126} {0: 1, 1: 0, 2: 1, 3: 8, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!