ID: 1160335204_1160335207

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160335204 1160335207
Species Human (GRCh38) Human (GRCh38)
Location 18:78032692-78032714 18:78032705-78032727
Sequence CCAAAGCAAAGCACGCCTGCCTG CGCCTGCCTGATTATGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!