ID: 1160359955_1160359967

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160359955 1160359967
Species Human (GRCh38) Human (GRCh38)
Location 18:78266801-78266823 18:78266838-78266860
Sequence CCCTCATGACACCTTGGCCTTGG GGTTGGGATAAAATCAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 544} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!