ID: 1160366954_1160366962

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1160366954 1160366962
Species Human (GRCh38) Human (GRCh38)
Location 18:78334748-78334770 18:78334787-78334809
Sequence CCAGATTTTGGTGTCATTTTCCC ACGTTGCTGGCTGCACTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!