ID: 1160370601_1160370618

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1160370601 1160370618
Species Human (GRCh38) Human (GRCh38)
Location 18:78369518-78369540 18:78369570-78369592
Sequence CCTCCTAGGCATCCAGGCAGAGG CCCAGGAAGGCTCAGTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!