ID: 1160380796_1160380804

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1160380796 1160380804
Species Human (GRCh38) Human (GRCh38)
Location 18:78453840-78453862 18:78453874-78453896
Sequence CCTCAGCTCATGGGAGGAAGACC TCCCAGGCAGCCCCCAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!