ID: 1160445621_1160445630

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1160445621 1160445630
Species Human (GRCh38) Human (GRCh38)
Location 18:78925026-78925048 18:78925069-78925091
Sequence CCTGGACGCCGTTTGCTCCAAGG CTTTTCATGCCCCTCACTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!