ID: 1160454696_1160454711

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1160454696 1160454711
Species Human (GRCh38) Human (GRCh38)
Location 18:78992436-78992458 18:78992477-78992499
Sequence CCTGCGGCCCCTGCACCCCCAAC CAGCACCAACGTGACCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 553} {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!