ID: 1160464424_1160464430

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160464424 1160464430
Species Human (GRCh38) Human (GRCh38)
Location 18:79064433-79064455 18:79064470-79064492
Sequence CCAGCTGGCCTGCATCTACTCCA TTGAGGTAGCCTTGCTCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!