ID: 1160503422_1160503429

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1160503422 1160503429
Species Human (GRCh38) Human (GRCh38)
Location 18:79413715-79413737 18:79413735-79413757
Sequence CCTGGTTCCTTCTTCGTCTCCTG CTGGGCGGCAAGGTGTCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!